Introduction

Top Abstract Introduction Materials and Methods Results Discussion Conclusions References

The antiepileptic drug valproic acid (VPA; 2-propyl-pentanoic acid) is a potent teratogen in both human and mouse. Epileptic women treated with this drug give birth to children with a risk of about 1 to 50 of having a defect in the closure of the neural tube (e.g., spina bifida occulta or aperta). Additional alterations that are collectively called the embryonic valproate syndrome include malformations of the facial skull and the heart (DiLiberti et al., 1984; Huot et al., 1987; Ardinger et al., 1988; Martinez-Frias, 1990, 1991). VPA treatment of pregnant mice induces litters with most of the embryos showing an incomplete neural tube closure (Nau et al., 1991). The type of defect depends on the time of application. Treatment at an embryonic age of 8.25 days after conception induces exencephaly, a closure defect of the anterior part of the neural tube, including malformations of the brain. Repeated treatments between the embryonic age of 9 and 9.5 induce closure defects of the posterior part of the neural tube, which become apparent at later stages as spina bifida.

It is likely that VPA acts on preexisting signaling pathways and cellular programs that are required for proper embryonic development around the time of neural tube closure. The existence of a specific interaction of VPA with cellular signaling events is supported by the finding that VPA teratogenicity in the mouse is subjected to stringent structure-activity constraints. Thus, introduction of a double bond between carbon 2 and 3 (2-en-VPA) renders the derivative nonteratogenic, although still antiepileptic. A triple bond between carbon 4 and 5 (4-yn-VPA) generates a derivative that is highly teratogenic, but relatively poorly antiepileptic. Teratogenicity of 4-yn-VPA is selective for the enantiomer applied; e.g., (S)-4-yn-VPA is highly teratogenic, whereas (R)-4-yn-VPA is not. Both forms do not differ with respect to their antiepileptic activity. An additional substitution in the second branch of the molecule, 4-yn,4'-Me-VPA renders the compound nonteratogenic (Nau et al., 1991; Hauck et al., 1992). The teratogenic compounds in this series of compounds are expected to affect either proliferation, differentiation, or function of cells during the sensitive time period of embryonic development. Teratocarcinoma cells, such as P19 or F9, have properties similar to those of early embryonic cells. Appropriate stimuli, such as retinoids, cAMP-signaling, growth factors, or lack of adhesion induce them to differentiate. Depending on the stimulus differentiated F9 cells show properties and marker gene expression of either endodermal, ectodermal, or mesodermal cells (Kellermann et al., 1987; Lehtonen et al., 1989). Indirect evidences suggest that also VPA could alter the properties of F9 cells (Lampen et al., 1999).

The goal of the present study was to identify conditions of VPA-induced differentiation, which are clearly defined by cellular and biochemical parameters. A model system of differentiation should be established that faithfully reflects the structure-activity relationship of teratogenicity among VPA derivatives. Furthermore, VPA-sensitive cellular signaling molecules were to be identified and their role in the VPA-dependent cellular responses clarified.

Using F9 (and P19) teratocarcinoma cells we demonstrated that VPA induces a specific type of cell differentiation, which differs from that induced by other established inducers of F9 cell differentiation. The search for a VPA-responsive "receptor" molecule was guided by the observation that VPA treatment of rodents induces proliferation of peroxisomes in liver cells (Horie and Suga, 1985; Ponchaut et al., 1991) and the chemical structure of VPA (e.g., a carboxylic acid). Induction of peroxisomal proliferation is mediated by a subgroup of the steroid receptor superfamily, the peroxisome proliferator-activated receptors (PPARs) (Forman et al., 1996; Willson and Wahli, 1997). Three forms are known, PPAR, PPAR, and PPAR, the latter of which is also called PPAR, FAAR, or NUC1. They have distinct expression patterns, are activated by various carboxylic acids, peroxisome proliferation-inducing drugs, or eicosanoids, and fulfil different nonredundant physiological functions (Issemann and Green, 1990; Göttlicher, 1992; Kliewer et al., 1994; Tontonoz et al., 1994; Amri et al., 1995), among which the role of PPAR is understood least.

We now extend previous data from a hybrid receptor approach (Lampen et al., 1999) by showing that VPA activates PPAR-dependent transcription also in the context of the native receptor. More importantly, stable expression of PPAR antisense RNA in F9 cells provides evidence for the fact that PPAR indeed is a limiting factor in the regulation of F9 cell differentiation rather than merely a surrogate marker for VPA-induced alterations in cell function.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion Conclusions References

Cell Culture and Drug Treatment. Culture of Chinese hamster ovary cells, stable transfection, and detection of the alkaline phosphatase reporter gene were performed as described previously (Göttlicher et al., 1992). F9 cells (American Type Culture Collection, Manassas, VA ) were cultured on dishes precoated with 0.1% gelatin in PBS. The culture medium was Dulbecco's modified Eagle's medium/Ham's F-12 (1:1) supplemented with 2 mM glutamine, 0.15 mM -mercaptoethanol, and 10% fetal bovine serum. VPA and derivatives, except for 2-en-VPA, were dissolved as liquids in the cell culture medium. 2-en-VPA and retinoic acid (RA) were added as solutions in dimethyl sulfoxide (1 M and 100 mM stock solutions, respectively). Sodium butyrate and dibutyryl-cyclic AMP were dissolved in aqueous media. Staining the F-actin cytoskeleton with BODIPYFL phallacidin followed the procedures recommended by the supplier (Molecular Probes, Eugene, OR).

Plasmid Construction. The expression vector for GR-PPAR was constructed by releasing the ligand-binding domain of PPAR from pMT-GR-PPAR (Göttlicher et al., 1992) by cleavage with XbaI (3') and Klenow fill-in followed by XhoI digestion (5'). The cDNA for the ligand-binding domain of PPAR was prepared from the Gal4-PPAR expression vector (Kliewer et al., 1994) as KpnI (Klenow-blunted)-BamHI fragment and subcloned into pGem7Zf prepared by KpnI (Klenow-blunted)-BamHI digestion. The fragment was recovered as a XhoI-BamHI (Klenow-blunted) fragment containing the vector-derived sequence tcgaGGAATTC as adaptor in the 5' end and cloned into the pMT-GR-vector prepared as described above.

RNA and Protein Analysis. Poly(A)⁺ RNA preparation and Northern blot analysis followed standard procedures. Probes for PPAR mRNA detection were fragments comprising nucleotides 378 to 519 of the rat PPAR cDNA (Göttlicher et al., 1992), corresponding to the amino acids 340 to 456 of PPAR2 (Tontonoz et al., 1994) and the 200-base pair PstI fragment of PPAR (FAAR) covering the translational start site (nucleotides 31-230) (Amri et al., 1995). AP-2 protein expression was detected by Western blot analysis of F9 cell nuclear extracts using a rabbit polyclonal antibody raised against an AP-2 peptide (Santa Cruz Biotechnology, Santa Cruz, CA). For nuclear extract preparation F9 cells were harvested by incubation in PBS without Ca²⁺ or Mg²⁺ containing 5 mM EDTA. Cell pellets were resuspended and lysed in a hypotonic buffer (25 mM Tris pH 7.6, 1 mM EDTA) containing 0.05% NP-40 for 20 min on ice. Nuclei were collected by centrifugation and subjected to lysis in a sample buffer for SDS acrylamide gel electrophoresis.

Transient Transfections. F9 cells were transfected in six-well culture dishes for 4 h by the calcium phosphate coprecipitation method. Transfection mixes contained 1 µg of the PDRE4-Mluc reporter gene together with 0.1 µg of renilla luciferase controlled by the ubiquitin C promoter for normalization and, if applicable, 0.2 µg of expression vectors for RXR and PPAR (Amri et al., 1995). Cells were treated for 17 to 20 h with 1 mM VPA before the analysis of reporter gene activity.

Gel Mobility Shift Analysis. Nuclear protein extracts from appropriately treated F9 cells were prepared by standard mild detergent lysis of cells (0.05% NP-40) and high salt extraction of nuclear proteins (20 mM Hepes, pH 7.9; 0.2 mM EDTA; 0.5 mM dithiothreitol; 1.5 mM MgCl₂; 420 mM NaCl; 25% glycerol; 0.5 mM phenylmethylsulfonyl fluoride). The salt concentration was reduced to a final concentration of 75 mM NaCl by dilution. Twenty-microliter bandshift reactions with 5 µg of nuclear protein were performed in a buffer (62 mM Tris-HCl, pH 7.8; 0.6 mM EDTA; 5 mM dithiothreitol; 75 mM NaCl; 6% glycerol) containing 2 µg of poly(dIdC) (Pharmacia, Freiburg, Germany) and 10 fmol of a ³²P-labeled probe. If appropriate antibodies or nonlabeled oligonucleotides were added, preincubation for 15 min on ice was followed by the addition of 0.1 pmol of the labeled probe. After 15 min at room temperature, samples were separated on a 5% acrylamide gel in 0.5× Tris borate buffer. The following oligonucleotides were used: PPAR-RE: CTAGCGTGAGCGCTCACAGGTCAATTCG and CTAGCGAATTGACCTGTGAGCGCTCACG; and AP-2-RE: TCGAACTGACCGCCCGCGGCCCGTGTGC and TCGAGCACACGGGCCGCGGGCGGTCAGT.

RNA in Situ Hybridization. RNA in situ hybridization was performed in accordance with standard procedures using a ³⁵S-labeled probe, which comprised 57 nucleotides of the 5' untranslated region and the first 1137 nucleotides of the FAAR open reading frame (Amri et al., 1995).

	Results

Top Abstract Introduction Materials and Methods Results Discussion Conclusions References

Differentiation of F9 Cells by VPA. Induction of F9 cell differentiation by VPA was analyzed using the criteria of altered cell morphology, reduced proliferation, and expression of marker genes. VPA treatment for 2 days induced profound changes in cell morphology, which were characterized by less tightly packed cells within the colonies and the generation of long filamentous structures. The latter were detected by staining of the F-actin cytoskeleton (Fig. 1). Cell proliferation was reduced by VPA, as reflected by reduced [³H]thymidine incorporation and cell recovery (Table 1).

View larger version (34K): [in this window] [in a new window]   Fig. 1.   VPA-induced changes in morphology of F9 teratocarcinoma cells. F9 cells were cultured on gelatin-coated plastic for 48 h in the presence or absence of 1 mM VPA. The F-actin cytoskeleton was stained with BODIPY-conjugated phallacidine (green fluorescence; Molecular Probes). Nuclei were stained with H33254. Culture dishes were cut to fit a microscope stage and micrographs of representative F9 cell colonies were taken using computer-aided deconvolution confocal imaging (Improvivon Labs, UK).

Laminin 1

View larger version (52K): [in this window] [in a new window]   Fig. 2.   VPA induces a specific type of F9 teratocarcinoma cell differentiation, which differs from that induced by retinoic acid. Differentiation of F9 teratocarcinoma cells was induced by exposure to 1 µM RA or 1 mM VPA for 1 or 3 days. A, abundance of the mRNAs for collagen (a1)IV, keratin 18, laminin 1, and gapdh for loading control was determined by Northern blot hybridization of 5 µg poly(A)+ RNA using probes described previously (Auer et al., 1994). B, induction of c-fos mRNA by VPA (1 mM) or RA (1 µM) was tested after 18 h. The figures show one of three experiments with similar results.

View larger version (45K): [in this window] [in a new window]   Fig. 3.   Expression of the AP-2 transcription factor in VPA-differentiated F9 cells. A, time course of appearance of AP-2 protein during treatment with 1 mM VPA was followed by Western blot analysis of nuclear extracts. B, presence of AP-2 in nuclear extracts after 48 h of VPA treatment (1 mM) was confirmed in an EMSA by complex formation with an AP-2 binding DNA element. The specific complex (AP-2), a nonspecific protein-DNA complex (NS), and the mobility of the AP-2 complex in the presence of an antibody against AP-2 (supershift, S-S) are indicated. Specificity of binding was shown by preincubating nuclear extracts with a nonlabeled DNA element ("cold") before addition of the radioactive probe. C, appearance of AP-2 protein was tested in F9 cells differentiated for 40 h by various agents [e.g., VPA (1 mM), RA (1 µM), dibutyryl cyclic AMP (db-cAMP, 1 mM)], a combination of the latter, or sodium butyrate (1 mM). Coomassie staining of a part of the gel confirmed comparable loading of lanes. One representative of three similar experiments each is shown.

Differentiation of F9 Cells by Teratogenic Rather Than Nonteratogenic VPA Derivatives. If F9 cell differentiation reflects a process occurring during VPA-induced disturbance of embryonic development, the same type of differentiation should be induced by teratogenic derivatives of VPA, but not by nonteratogenic derivatives. A set of closely related derivatives, including the stereoisomers of 4-yn-VPA, was therefore tested for the induction of c-fos mRNA and AP-2 protein. The parental compound and teratogenic (S)-4-yn-VPA, but not the nonteratogenic or poorly teratogenic derivatives (R)-4-yn-VPA, 4-yn-4'-methyl-VPA, and 2-en-VPA, induced c-fos mRNA (Fig. 4A) and AP-2 protein (Fig. 4B). Moreover, proliferation was only inhibited by 1 mM (S)-4-yn-VPA, but not by (R)-4-yn-VPA [i.e., thymidine incorporation was reduced by 51 ± 3 and 8 ± 5%, respectively (data not shown)]. The identical stringent structural requirements for VPA derivatives to induce differentiation of F9 cells and disruption of embryonic development suggest that both effects are caused by the same primary action of VPA on cellular signaling molecules.

View larger version (58K): [in this window] [in a new window]   Fig. 4.   Selective induction of c-fos mRNA and AP-2 protein by teratogenic, but not by nonteratogenic VPA derivatives. Inducibility of c-fos mRNA and AP-2 protein by derivatives of VPA was determined as described in Figs. 2 and 3. A, c-fos induction was determined after 8 h of exposure to 1 mM VPA or its derivatives and AP-2 protein was detected after 48 h (B). Similar results were obtained in three independent experiments and equal loading of samples was confirmed by hybridization with a gapdh probe or Coomassie staining of a part of the gel.

Activation of PPAR by VPA and Teratogenic Derivatives. Prominent components in the cellular signaling network, which respond to small diffusible compounds, are the members of the steroid hormone receptor superfamily. Retinoid receptors are present in F9 cells (Boylan et al., 1995; Kastner et al., 1995) but are not likely to mediate the response to VPA because RA induced a different type of differentiation. PPARs are candidates of VPA-responsive receptors, because they respond to a wide variety of carboxylic acids (Göttlicher et al., 1992; Kliewer et al., 1997; Willson and Wahli, 1997). In a previous study, it was shown that even at a concentration of 0.5 mM, VPA activated a hybrid protein, comprising the DNA-binding domain of the glucocorticoid receptor and the ligand-binding domain of PPAR (Göttlicher et al., 1992; Lampen et al., 1999). At a concentration of 4 mM, VPA activated PPAR as efficiently as the established ligand iloprost (10-fold; data not shown). PPAR was selectively activated by VPA and its teratogenic derivatives, but not by the nonteratogenic derivatives (Lampen et al., 1999). PPAR was activated only 3-fold even by 4 mM VPA, and PPAR activation was not sensitive to modification of the VPA-molecule [i.e., all derivatives used in this study activated PPAR to the same low degree (data not shown)]. The lack of activation of the full-length glucocorticoid receptor served as negative control (data not shown). Fatty acids and other compounds are known to activate several forms of PPARs. In accordance with this promiscuity, PPAR was activated selectively by VPA and the teratogenic derivatives, but not by nonteratogenic compounds. The same specificity was found as in the case of PPAR (data not shown).

View larger version (30K): [in this window] [in a new window]   Fig. 5.   Expression of PPAR isoforms in F9 teratocarcinoma cells. A, abundance of PPAR-isoforms was analyzed by Northern blot hybridization of 10 µg of poly(A)+ RNA isolated from nontreated F9 cells. RNA isolated from mouse liver (L), adrenal (A, 14 µg total RNA), or kidney (K) served as control. The arrows indicate the sizes of the detected mRNA species (PPAR, 8.5 kb; PPAR, 1.9 kb; PPAR, 3.5 kb) calculated from the mobility of 18S and 28S rRNA. B, presence of PPAR protein in nuclear extracts was tested by gel mobility shift analysis (right) using a DNA probe specifically selected for binding of PPAR (He et al., 1999). Specific DNA binding was displaced by a 300-fold excess of unlabeled oligonucleotide (right). The lower half of the gel with the free probe is not shown. Similar results were obtained in two independent experiments. C, inducibility of PPAR-dependent gene expression was tested by transient transfection of the PDRE4-Mluc reporter gene into F9 cells without or with coexpression of PPAR and murine RXR. Cells were left untreated () or treated with 1 mM VPA for 17 h () before analysis of reporter gene activity. Values are averages ± S.D. from a total of four determinations in three independent experiments that were normalized in comparison to noninduced reporter gene activities in the absence of receptor expression. Inducibility by VPA was significant (P < 0.005, Student's t test) in either pair of values. The effect of receptor coexpression was also moderately significant if untreated or VPA-treated samples were compared, respectively (P < 0.05).

Role of PPAR in the Differentiation of F9 Cells. The activation of PPAR suggests that this receptor might mediate VPA effects in F9 cells. PPAR-deficient F9 cell clones were generated by the stable expression of antisense RNA to find out whether PPAR caused the differentiation of F9 cells or whether PPAR activation should rather be considered a surrogate marker for VPA action. Antisense RNA was expressed in a tetracyclin-dependent expression system (Tet-off) together with an expression cassette for luciferase. Three F9 cell clones of approximately 200 screened clones were identified, which expressed the transfected construct at high levels as assessed by luciferase measurements. However, none of the clones was responsive to tetracyclin. Considering the lack of suitable antibodies, the presence of PPAR protein was assessed indirectly by EMSA with a PPAR-specific probe (Fig. 6A). The EMSA pattern differed between wild-type F9 parental cells and cells ectopically expressing the tet-off trans-activator on one side and the three PPAR antisense RNA expressing cells on the other side. One protein DNA complex (middle) was completely lost in the antisense cells, thus indicating that this band probably corresponded to a PPAR-dependent complex and that antisense RNA expression was efficient in preventing PPAR protein synthesis. These clones were resistant to the VPA-dependent decrease in the proliferation rate (determined as described in Table 1; data not shown) and to the induction of AP-2 protein (Fig. 6B). The result showed that PPAR indeed serves as a limiting factor in F9 cell differentiation.

View larger version (50K): [in this window] [in a new window]   Fig. 6.   PPAR DNA-binding activity and induction of AP-2 by VPA in PPAR antisense RNA expressing cells. PPAR antisense RNA expressing F9 cells were tested for PPAR-like DNA-binding activity in nuclear extracts and inducibility of AP-2 protein by VPA treatment. A, EMSA for DNA-binding of PPAR was performed as described in Fig. 5. Wild-type cells and PPAR expressing parental cells of the subclones (F9tetoff) were analyzed in comparison to three subclones of F9tetoff, which expressed an antisense RNA directed against PPAR. Only the indicated band () was considered to depend on PPAR because the other bands (, N.S.) were not affected by antisense RNA expression. For reasons of resolution only the top third of the gel is shown. B, AP-2 was detected as described in Fig. 3 after treatment of cells for 48 h with 1 mM VPA. One representative of three independent experiments is shown.

Presence of PPAR in the Developing Embryo. Studies in F9 cells suggest that inappropriate activation of PPAR might also mediate VPA teratogenicity in vivo. This would require the expression of the receptor during the VPA-sensitive time of embryogenesis. Therefore, PPAR expression was analyzed by RNA in situ hybridization. Eight days after conception, before the VPA-sensitive period, a weak expression only was found throughout the embryo cross-section (Fig. 7, A-E) with a slightly prominent signal in the neuroectoderm of the anterior neural fold (arrowheads in Fig. 7, A, B, D, and E). Although weak, the signal was clearly above the background obtained with a sense instead of the antisense probe (Fig. 7F). Using the antisense probe, a strong specific signal was found in extraembryonic tissues (Fig. 7, A and D). At 9.5 days after conception, ubiquitous staining was found throughout the whole embryo cross-section (Fig. 7, G-I) and at 10.5 days after conception, the expression seemed to be enhanced (arrowheads) along a line surrounding the neural tube as well as a more lateral line in the mesoderm on each side of the embryo (arrow, Fig. 7, K-M). This location reminds of the medial (along the neural tube) and lateral migration paths of NCCs. This finding, together with the VPA induction of the AP-2 transcription factor preferentially expressed in NCCs, suggested that the differentiation or function of NCCs could be the target of VPA action in the embryo.

View larger version (123K): [in this window] [in a new window]   Fig. 7.   In situ detection of PPAR mRNA during the VPA-sensitive time window in embryonic development. PPAR expression was detected by mRNA in situ hybridization in transversal sections of embryos at 8 (A-F), 9.5 (G-I), and 10.5 (K and L) days after conception. Left panels show autoradiographic developments of the antisense probe hybridization in dark field micrographs. Middle panels show the identical frames as bright field micrographs for orientation. Scale bars, 500 µm each. The right column either shows a schematic drawing for approximate orientation of the section planes (C and M), where the plane for the embryo 9.5 days after conception is also indicated in the corresponding region of the schematic drawing at 10.5 days after conception. F and I show hybridizations of serial sections to those shown in D and G. For control purposes they were hybridized with a sense RNA probe. Image processing for those frames exactly corresponded to that of the corresponding antisense RNA hybridized sections. Indicated structures are ba, branchial arch; md, mesoderm; ne(a), anterior neuroepithel (also arrow head); ne(p), posterior neuroepithel; nf, neural fold; nt, neural tube; ov, otic vesicle; tb, trophoblast; tv,.telencephalic vesicle; v(iv), forth ventricle.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion Conclusions References

VPA Induces a Specific Type of F9 Cell Differentiation. The disruption of proper embryonic development by a small teratogenic chemical such as VPA during a precisely defined time window requires the compound to interfere with preexisting signaling pathways and the proper execution of cellular programs. This study was aimed at defining such a VPA-inducible cellular program by using the differentiation of pluripotent F9 embryocarcinoma cells as a model system. The main finding is that VPA induces a specific type of differentiation, which is characterized by a dramatic increase in the AP-2 transcription factor protein. Markers of other types of differentiation are missing. Parietal endoderm-like cells, for example, express laminin 1 and collagen IV (Strickland et al., 1980; Kellermann et al., 1987; Sleigh, 1987; Edwards et al., 1988; Alonso et al., 1991). These markers are induced by RA, but not by VPA. The 3-fold induction of the keratin 18 mRNA by VPA could indicate induction of primitive or visceral endodem-like cells, which, however, are supposed to show a different morphology than that observed (Kellermann et al., 1987; Sleigh, 1987; Alonso et al., 1991). Neither does a protocol that induces neuronal differentiation [e.g., RA and dibutyryl cyclic AMP (Wartiovaara et al., 1984) induce AP-2 expression (data not shown)]. Thus, VPA-induced differentiation to AP-2 expressing cells apparently defines a novel type of F9 cell differentiation. Because AP-2 expression is initiated during normal embryogenesis in premigratory NCCs at 8 days after conception (Mitchell et al., 1991; Schorle et al., 1996), F9 cells differentiated by VPA may resemble features of NCCs. The induction of AP-2 seems to involve cell type-specific elements, because RA induces AP-2 in NT2 tertatocarcinoma cells (Lüscher et al., 1989), but not in F9 cells treated with RA for up to 2 days.

Correlation of Induction of F9 Cell Differentiation with Teratogenicity. If the F9 cell model simulates events occurring during the disruption of proper embryonic development by VPA, structure-activity relationships for derivatives of VPA should be identical for both the differentiation of F9 cells and teratogenicity. Indeed, differentiation is only induced by the teratogenic, but not by the nonteratogenic compounds. This correlation also holds during a more extensive analysis of structure-activity relationships, including six teratogenic and six nonteratogenic derivatives of VPA, when testing an indirect marker of differentiation [e.g., the derepression of the Rous sarcoma virus promoter (Lampen et al., 1999)].

PPAR in the Control of F9 Cell Differentiation. Specific induction of differentiation requires a target in the normal cellular signaling network, through which VPA acts on preexisting cellular programs by inappropriate activation or inhibition. The present data suggest that PPAR is part of this VPA-sensitive signaling network. PPAR mRNA is expressed in F9 cells, and functional protein is synthesized. PPAR mRNA is also present in the embryo at the relevant time (Fig. 7). A comparable study in rat embryos (Braissant and Wahli, 1998) and an earlier analysis of RNA from whole mouse embryos (Kliewer et al., 1994) also support the sufficiently early presence of PPAR in the embryo. Furthermore, VPA levels in vivo (Nau et al., 1981) reach those required for F9 cell differentiation (this study) and PPAR activation in cell culture (Lampen et al., 1999), so that activation of the expressed receptor in the embryo is expected. Also PPAR, but not PPAR, was activated in vitro selectively by VPA and the teratogenic derivative. These receptors may be relevant to other aspects of VPA action, such as peroxisomal proliferation, but they are not likely to mediate teratogenicity due to a lack of expression during the VPA-sensitive time window. Structure-activity relationships also indicate that activation of PPAR and the described type of cell differentiation are not the mechanisms of the antiepileptic activity of VPA because some derivatives do neither induce differentiation nor activate PPAR but nevertheless suppress epileptic seizures. To provide support for the proposed role of PPAR in the differentiation of F9 cells, we generated three subclones that expressed PPAR mRNA in antisense orientation. In these cells VPA did not induce any sign of differentiation. The most simple interpretation was that PPAR mediates the effects of VPA. It could not be excluded, however, that depletion of PPAR by antisense RNA expression primarily altered the state of F9 cell differentiation in a way that VPA sensitivity was lost indirectly. In either case, these findings suggest that PPAR is part of the signaling network that controls F9 cell differentiation and directly or indirectly related to the action of VPA. Evidence for the proposed role of PPAR in embryonic development and VPA teratogenicity still requires an analysis of PPAR-deficient gene knockout mice.

	Conclusions

Top Abstract Introduction Materials and Methods Results Discussion Conclusions References

To sum up, specific nuclear receptor activation and differentiation of F9 cells provide a model system for molecular and cellular events triggered by VPA and its teratogenic derivatives. Structure-activity relationships suggest that the effects described in F9 cells reflect at least some of the events that occur during VPA-induced disturbance of embryonic development in vivo. VPA teratogenicity is likely to involve complex cellular programs and the regulation of numerous gene activities. Nevertheless, the relatively simple model in F9 cells is suitable to define mechanisms of action and suggests that PPAR plays a major part in the cellular response to VPA.